#! perl
use strict;
use warnings;


# read data sequence from user
my $data = "TGCAACTGCATACGTACTCGACTGCATT";

# read separator from user
my $separator = "TG";


# split sequence into parts
my @splitted = do {

	# open filehandle for input data; maybe a filename later?
	open( my $fh, '<', \$data ) or die "Could not open data.";

	# set input field separator (it is NOT removed from the resulting parts)
	local $/ = $separator;

	# read parts from filehandle (list context because of @splitted)
	<$fh>;
};

# control; print each part in @splitted per line
print join "\n", @splitted, "";